rs176648 chr15:89396297 T>G
- Sequence
actgtcggttagggagtgtaaatt[T/G]tgcaatattttctgaaatgtggca
- ASB in cell types
- MOLM-13(acute monocytic leukemia(AML), Homo sapiens) CD14+ monocytes LHSAR (prostate epithelial cells) MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- STAT1_HUMAN REQU_HUMAN BRD7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | -1.34 | 2.97 | 2.00 | n/a | No Hit | |||
| REQU_HUMAN | -2.83 | 1.89 | 1.50 | n/a | n/a | |||
| BRD7_HUMAN | -3.10 | 1.96 | 1.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, cystatin c in serum, height, infant head circumference
GTEx eQTL Brain_Caudate_basal_ganglia, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Lung, Thyroid