rs1789924 chr4:99353129 C>T
- Sequence
ttttgaatccacatggtgcagtta[C/T]gaaggaggagtagggaaattggat
- ASB in cell types
- tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial nerve | 2.14 | -1.80 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alcohol dependence, aortic valve calcium, birth weight, eye color, ldl cholesterol, maternal transmission distortion, total cholesterol, transmission distortion, triglycerides, triglycerides change with statins, upper aero-digestive tract cancer
PheWAS abnormal loss of weight and underweight, acquired deformities of ankle and foot, acute pericarditis, acute renal failure, acute sinusitis, acute upper respiratory infections, adverse drug events and drug allergies, adverse effects of antilipemic and antiarteriosclerotic drugs, adverse effects of cardiac rhythm regulators, alzheimers disease, anemia in neoplastic disease, aneurysm and dissection of heart, behcets syndrome, bladder neck obstruction, blood in stool, brain cancer, bursitis, calculus of lower urinary tract, cancer of kidney and renal pelvis, cancer of other male genital organs, cardiac shunt/ heart septal defect, cellulitis and abscess of face, cholelithiasis with other cholecystitis, chronic hepatitis, chronic liver disease and cirrhosis, chronic nonalcoholic liver disease, colostomy and enterostomy complication, congenital musculoskeletal anomalies, decreased white blood cell count, delirium dementia and amnestic disorders, delirium due to conditions classified elsewhere, dementias, dermatomyositis and polymyositis, diseases of white blood cells, disorders of the pituitary gland and its hypothalamic control, disorders of tooth development, disturbances in tooth eruption, edema, eustachian tube disorders, functional disorders of bladder, glaucoma, graves disease, h. pylori, hemorrhage in early pregnancy, hypertension complicating pregnancy, incisional hernia, intestinal infection, intestinal malabsorption nos, late effects of cerebrovascular disease, leukoplakia of oral mucosa, mental disorders due to brain damage, nausea and vomiting, neutropenia, open-angle glaucoma, orthostatic hypotension, other disorders of bladder, other disorders of gallbladder, other disorders of metabolism, other dyschromia, other specified nonpsychotic and/or transient mental disorders, otosclerosis, periodontitis (acute or chronic), peripheral arterial disease, peripheral vascular disease, posterior pituitary disorders, psychogenic disorder, renal cell carcinoma, retinal vascular changes and abnomalities, sialoadenitis, symptoms of the muscles, thoracic neuritis/radiculitis, urethral stricture (not specified as infectious), vitamin b12 deficiency anemia
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid