rs1791398 chr18:3656488 T>C
- Sequence
accagcacttcctctttgatactg[T/C]atctagagatcatctgatgcatgt
- ASB in cell types
- MDM(monocyte derived macrophages) CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.11 | -0.67 | 2.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.37 | 1.21 | 1.00 |
Items per page:
1 – 2 of 2