rs1792174 chr11:73787888 T>G
- Sequence
gctgcacctggtcaaggccgttcc[T/G]tcagtgttttcagacgccctggga
- ASB in cell types
- A549 (lung carcinoma) neural cell WA01 (H1, human embryonic stem cells) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- KLF1_HUMAN TAL1_HUMAN JUN_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KLF1_HUMAN | -1.41 | 2.16 | 1.25 | n/a | No Hit | |||
| TAL1_HUMAN | 2.24 | -2.06 | 1.00 | n/a | No Hit | |||
| JUN_HUMAN | 0.45 | 1.21 | 1.92 | n/a | No Hit | |||
| TYY1_HUMAN | 0.60 | 0.93 | 2.29 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, college completion, ldl cholesterol, triglycerides change with statins, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood