rs1792361 chr11:92710759 C>T
- Sequence
gatacatgcacaaaaccatttacc[C/T]gtcttcaaaaatgatgcttccaga
- ASB in cell types
- neural cell
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | -1.44 | 1.77 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, college completion, hypertension (early onset hypertension), irritible bowel syndrome, ldl cholesterol, parkinsons disease, prostate cancer, spine bone mineral density (bmd), triglycerides, type 2 diabetes, combined control dataset, gender differentiated, years of education