rs1792695 chr18:56115669 T>G
- Sequence
cctgatgagcctgcctcaacttgc[T/G]tcttccctttggaaagtacagcaa
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.27 | 0.22 | 2.06 | 1.79 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
