rs1792936 chr11:62133434 G>C
- Sequence
cctgcctcctggcctggtgcgcac[G/C]tgcctgcggggcccatcgggcagc
- ASB for transcription factors
- ZIC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | 2.42 | -2.26 | 1.00 | 1.80 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
