rs1797659 chr12:12033519 C>T
- Sequence
ttggacttgacagcgtgtgtgtag[C/T]gccacctggtgaccacagcttatc
- ASB in cell types
- erythroid progenitors GM10847 (female B-cells Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 2.42 | n/a | 2.50 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 0.44 | -0.32 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 0.47 | 0.12 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 0.34 | -0.18 | 1.00 |
Items per page:
1 – 4 of 4