rs1797886 chr3:12480199 C>T
- Sequence
ctggaatttaagcgcctccacaat[C/T]ggtccccaccctacctatcggacc
- ASB in cell types
- A549 (lung carcinoma) foreskin keratinocyte hepatocytes GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.07 | 0.92 | 1.98 | |||
| foreskin keratinocyte | 1.08 | -3.70 | 2.33 | |||
| hepatocytes | 1.59 | -1.07 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.65 | 0.65 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid