rs1799281 chr19:48445513 G>A
- Sequence
ttgactgcccctagagggtagatt[G/A]aaccgcctaacttacagataatat
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts 22RV1 (prostate carcinoma) iPS-derived dermal fibroblasts GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- GATA1_HUMAN ZN217_HUMAN RARA_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | n/a | 3.27 | 2.00 | n/a | No Hit | |||
| ZN217_HUMAN | -1.84 | 2.33 | 2.00 | n/a | n/a | |||
| RARA_HUMAN | 1.76 | -0.11 | 1.00 | -1.51 | Weak Concordant | |||
| STAG1_HUMAN | 0.86 | 0.01 | 1.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, fasting insulin, hdl cholesterol, neuroblastoma (brain cancer), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Small_Intestine_Terminal_Ileum, Thyroid, Whole_Blood