rs1799877 chr14:20613296 G>T
- Sequence
tgtgctttgcttcttcacatccct[G/T]gggagttaatagctgcaatttttc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) A549 (lung carcinoma) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- ETS1_HUMAN SKIL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | -0.74 | 1.37 | 1.33 | n/a | No Hit | |||
| SKIL_HUMAN | 2.25 | -1.91 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2