rs1799964 chr6:31574531 T>C
- Sequence
gaagcaaaggagaagctgagaaga[T/C]gaaggaaaagtcagggtctggagg
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 2.32 | n/a | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), crohns disease, cystatin c in serum, flucloxacillin drug-induced liver injury, height, hiv-1 control, irritible bowel syndrome, ldl cholesterol, rheumatoid arthritis, total cholesterol, triglycerides, type 1 diabetes, combined control dataset
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood