rs1800180 chr12:57175730 G>A
- Sequence
gtgagacaacagtgaggtgtggtg[G/A]ggcaggccgaggcaggcctctgag
- ASB in cell types
- hTERT-HME1(Telomerase immortalized cell line)
- ASB for transcription factors
- BRCA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRCA2_HUMAN | -0.16 | 2.17 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas