rs1800378 chr12:6063036 T>C
- Sequence
aggcgcacggaggccgtcactgta[T/C]gctggatgcggaggtcacctggaa
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 1.63 | -0.83 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, body mass index (bmi), hip bone mineral density (bmd), hypertension (early onset hypertension), obesity (body mass index (bmi)), spine bone mineral density (bmd), stabilized warfarin dose, tetrology of fallot