rs1800437 chr19:45678134 G>C
- Sequence
ctggtgcccctgctgggtgtccac[G/C]aggtggtgtttgctcccgtgacag
- ASB in cell types
- foreskin keratinocyte RWPE2 transverse colon MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.38 | 3.01 | 1.92 | 3.00 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
EMBL-EBI body fat percentage, body mass index, body mass index (joint analysis main effects and physical activity interaction), body mass index in physically active individuals, gip levels in response to oral glucose tolerance test (120 minutes), gip levels in response to oral glucose tolerance test (fasting), insulin levels in response to oral glucose tolerance test (30 minutes), obesity, type 2 diabetes (adjusted for bmi)
GRASP 2 hour glucose, body mass index (bmi), college completion, fasting blood glucose, hdl cholesterol, ldl cholesterol, obesity class, serum creatinine, total cholesterol