rs1800544 chr10:111076745 G>C
- Sequence
cgttgcgttctgctccgtcggccc[G/C]gagctgcatggccaactcccagca
- ASB in cell types
- foreskin keratinocyte Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.58 | -1.27 | 3.00 | |||
| Kelly (neuroblastoma) | 1.07 | 0.31 | 1.00 |
Items per page:
1 – 2 of 2