rs1800668 chr3:49358324 G>A
- Sequence
agcggagcgccccgaacaagcact[G/A]taaggggaggccagcaggcgcctc
- ASB in cell types
- HepG2 (hepatoblastoma) WA09 (embryonic stem cells)
- ASB for transcription factors
- TBP_HUMAN TP53B_HUMAN TFE3_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBP_HUMAN | 0.07 | 0.73 | 1.31 | 3.77 | Concordant | |||
| TP53B_HUMAN | 2.42 | -2.16 | 1.00 | n/a | n/a | |||
| TFE3_HUMAN | 2.49 | -2.22 | 1.00 | n/a | No Hit | |||
| JUN_HUMAN | 0.07 | 1.46 | 3.83 | n/a | No Hit | |||
| NC2A_HUMAN | -1.60 | 1.60 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GRASP college completion, fasting blood glucose, fasting insulin, homa-ir, ldl cholesterol, serum creatinine, systolic blood pressure (sbp), total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood