rs1800752 chr11:6619638 A>G
- Sequence
gcctggtcccctgggaatcaccac[A/G]agtgagtgggctgtagagacccac
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- BHE40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BHE40_HUMAN | n/a | 2.81 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Stomach