rs1800812 chr4:54228462 G>T
- Sequence
gctttttttgtatgcgagatagaa[G/T]ccagggcaacctcgcccagataac
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM18951 (B-cells Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- RARA_HUMAN CTCF_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 1.42 | 0.63 | 1.00 | -3.25 | Concordant | |||
| CTCF_HUMAN | 0.98 | 0.79 | 1.22 | n/a | No Hit | |||
| IKZF2_HUMAN | 2.06 | 1.23 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, corneal curvature, height, systolic blood pressure (sbp), total cholesterol