rs1800949 chr6:131807424 C>T
- Sequence
aatatcccttacgtgtgttcagta[C/T]atgtgaacccacgtattttaagtg
- ASB in cell types
- adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | 2.24 | -2.06 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, chronic kidney disease, diastolic blood pressure (dbp), height, prop taste detection threshold, rheumatoid arthritis
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood