rs1808575 chr11:44556742 G>C
- Sequence
aggtgatctgcccgcctcaacctc[G/C]caaaatgctggggttacaggcatg
- ASB in cell types
- HCT-116 (colon carcinoma) neural progenitors adrenal gland 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.96 | 0.56 | 1.20 | n/a | No Hit | |||
| RAD21_HUMAN | 0.95 | -0.34 | 1.30 | n/a | n/a |
Items per page:
1 – 2 of 2