rs1808693 chr17:67491364 A>G
- Sequence
caatgccgggccgttcattaagaa[A/G]tgctttctgggtcatctgggtgca
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.96 | 1.28 | 2.40 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, body mass index (bmi), infant head circumference, microalbuminuria, spine bone mineral density (bmd), urinary albumin-to-creatinine ratio