rs1809140 chr15:24847411 C>T
- Sequence
tcccaacacactgggaggccgagg[C/T]gggcagatcacttgaggccaggag
- ASB in cell types
- bipolar neuron IPSC-derived bipolar neuron PANC1 (pancreatic ductal adenocarcinoma) LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 1.88 | -1.67 | 1.00 | |||
| IPSC-derived bipolar neuron | 1.99 | -0.81 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 1.59 | -4.15 | 2.00 | |||
| LNCaP C4-2B (prostate carcinoma) | -0.54 | 1.28 | 1.00 |
Items per page:
1 – 4 of 4