rs1809305 chr10:13984780 G>A
- Sequence
cattcatccatcagcgggcacttg[G/A]gttgtttccactttttggctactg
- ASB in cell types
- MDA-MB-231 (breast adenocarcinoma) CFPAC-1(pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-231 (breast adenocarcinoma) | 0.03 | 1.75 | 1.95 | |||
| CFPAC-1(pancreatic ductal adenocarcinoma) | -0.10 | 0.99 | 1.50 |
Items per page:
1 – 2 of 2