rs1810502 chr20:50440951 C>T
- Sequence
tggaaaggtgtgagtcatgcatca[C/T]ggaacagaaggttcacagccagga
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) HCASMC (Human coronary artery smooth muscle cells) HKC8 (kidney proximal tubule cell line)
- ASB for transcription factors
- ARI1B_HUMAN HTF4_HUMAN ZN189_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | 1.42 | n/a | 2.00 | n/a | n/a | |||
| HTF4_HUMAN | 2.53 | -0.13 | 2.00 | n/a | No Hit | |||
| ZN189_HUMAN | 2.17 | n/a | 2.00 | 4.41 | Discordant | |||
| JUN_HUMAN | 1.50 | n/a | 2.75 | n/a | No Hit | |||
| SMCA4_HUMAN | 1.94 | -4.55 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 16
Motif analysis
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, college completion, decrease in fev1/fvc ratio (in nonasthmatic participants), fasting blood glucose, ldl cholesterol, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in nonasthmatic participants), parkinsons disease, serum creatinine, total cholesterol, years of education