rs1811272 chr2:56130711 C>A
- Sequence
ctaggaaattaaattgctcatgta[C/A]ctggaagtctagaagatcatgcaa
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | -0.13 | 1.16 | 1.08 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, birth weight, childhood acute lymphoblastic leukemia, height, homa-b, simpson-angus scale, spine bone mineral density (bmd), tardive dyskinesia, tetrology of fallot