rs1811446 chr4:4226335 G>T
- Sequence
gcagacaggaaagctaggaaagat[G/T]cacagagagaccaaggcagaaaag
- ASB in cell types
- bipolar neuron
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 3.32 | 0.10 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Lung, Skin_Sun_Exposed_Lower_leg, Testis