rs1814597 chr8:97775353 G>A
- Sequence
gcctgaccaacatggtgaaacccc[G/A]tctctactaaaaatacaacaaatt
- ASB in cell types
- K562 (myelogenous leukemia) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.00 | 0.05 | 2.00 | |||
| upper lobe of left lung | -1.91 | 2.40 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Whole_Blood