rs1814822 chr3:117036737 T>C
- Sequence
aacttggattcctgacttccctca[T/C]ccttgccctacacacttaattaaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CD14+ monocytes MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- COT1_HUMAN IKZF1_HUMAN STAT1_HUMAN CDK8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | -4.37 | 4.05 | 1.00 | 4.37 | Concordant | |||
| IKZF1_HUMAN | -1.49 | 1.42 | 1.50 | n/a | n/a | |||
| STAT1_HUMAN | -0.92 | 1.76 | 2.00 | n/a | No Hit | |||
| CDK8_HUMAN | -0.21 | 1.50 | 1.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), ldl cholesterol change with statins, serum creatinine, total cholesterol change with statins, triglycerides change with statins