rs1816391 chr5:57825415 G>A
- Sequence
aatttgctctaggccattcagcta[G/A]gaagttgttgaatctgatacagat
- ASB in cell types
- embryonic kidney cortex iPS-derived chondrocytes HEK293T (embryonic kidney)
- ASB for transcription factors
- SIX2_HUMAN PKNX1_HUMAN RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SIX2_HUMAN | n/a | 3.38 | 1.50 | n/a | No Hit | |||
| PKNX1_HUMAN | -4.75 | 2.65 | 2.00 | n/a | No Hit | |||
| RARA_HUMAN | -0.03 | 1.45 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, bipolar disorder, fasting blood glucose, mitral annular calcium, rheumatoid arthritis, serum creatinine