rs1819372 chr9:101226960 G>C
- Sequence
atcttctgtgaggtagcggaacct[G/C]aaaggtgatgaccacatgggggca
- ASB in cell types
- GM23338
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.10 | 0.10 | 1.46 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), diastolic blood pressure (dbp), hdl cholesterol change with statins