rs1821178 chr2:221310100 C>T
- Sequence
gcaattacagcccacttgaaaatg[C/T]ctttgcagaaggctgaaatctgat
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 3.02 | n/a | 2.00 |
Items per page:
1 – 1 of 1