rs1822151 chr15:70974082 G>A
- Sequence
tggaggttgcggtgagccgagatc[G/A]cgccactgcactccagcctggcaa
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -0.06 | 1.38 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | -1.88 | 1.14 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Nerve_Tibial, Thyroid