rs182286 chr3:6204964 T>C
- Sequence
cctgccctaggccacttctgagga[T/C]ggttgcattcctctttgtgtcccc
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.50 | -0.81 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -0.61 | 1.66 | 1.00 | |||
| GM02630 (Fanconi anemi) | 0.89 | -0.89 | 1.00 |
Items per page:
1 – 3 of 3