rs182365 chr1:235513988 G>T
- Sequence
aaagagcttgcctctttttgcctc[G/T]tttggtttggtttggtttggtttt
- ASB in cell types
- A549 (lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line) LNCaP (prostate carcinoma) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.92 | 0.34 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.72 | 1.00 | 1.05 | |||
| LNCaP (prostate carcinoma) | 0.70 | 0.07 | 1.20 | |||
| HeLa S3 (cervical adenocarcinoma) | -0.03 | 1.05 | 1.36 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP height, ldl cholesterol change with statins, parkinsons disease, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Spleen, Thyroid, Whole_Blood