rs1827128 chr4:132227432 A>C
- Sequence
ctgggcctggggaaccactaccac[A/C]tagacgcggagactggtagtggct
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCASMC (Human coronary artery smooth muscle cells) | n/a | 0.92 | 3.00 |
Items per page:
1 – 1 of 1