rs1827321 chr19:51122452 A>G
- Sequence
aaaattaacctggcgtggcggcac[A/G]tgcctgtaatcccagctactcagg
- ASB in cell types
- K562 (myelogenous leukemia) monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.04 | 0.85 | 2.00 | |||
| monocytes from periferal blood | 2.31 | n/a | 3.00 |
Items per page:
1 – 2 of 2