rs1828168 chr5:98774369 A>C
- Sequence
cacctctgtcgggctccgggccac[A/C]gtaacgcagccacccaccgggcgg
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.46 | -0.46 | 1.83 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Muscle_Skeletal, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Stomach, Testis, Thyroid, Whole_Blood