rs1829483 chr2:7514013 C>T
- Sequence
gtttttgtgtgtgagcatctatac[C/T]tcagagccagcaatggtgcactga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived dendritic cells
- ASB for transcription factors
- IKZF2_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 1.83 | -0.83 | 1.00 | n/a | n/a | |||
| IKZF1_HUMAN | 1.34 | -0.71 | 1.25 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, eye color, fasting blood glucose, hdl cholesterol, neuroblastoma (brain cancer), parkinsons disease, rheumatoid arthritis, total cholesterol