rs1833907 chr5:35904512 G>T
- Sequence
catttagtcatttggagccacatg[G/T]ctgtcccagggcctggtccccagg
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 0.03 | 2.57 | 1.25 | n/a | n/a |
Items per page:
1 – 1 of 1