rs1834453 chr8:6690572 A>T
- Sequence
aatagaaaaaaaggaagaaaagaa[A/T]cgtaaatagggacttcccatcccc
- ASB in cell types
- macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 2.10 | -0.25 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), ldl cholesterol change with statins, obesity with early age of onset (age >2), total cholesterol change with statins