rs1835649 chr21:27678760 G>T
- Sequence
cattgccatgtgacattctctttt[G/T]aatgggacaataataaatgaaaag
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 0.02 | 0.72 | 1.44 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, ldl cholesterol, obesity with early age of onset (age >2), refractive error, systolic blood pressure (sbp), triglycerides