rs1836882 chr11:89498993 T>C
- Sequence
atctaatttcatgaagcactacag[T/C]ataaggcttgcggtgaggtttctt
- ASB in cell types
- Kasumi-1 (acute myeloblastic leukemia) PC9 (lung adenocarcinoma) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kasumi-1 (acute myeloblastic leukemia) | -0.60 | 1.78 | 1.00 | |||
| PC9 (lung adenocarcinoma) | 2.13 | -1.59 | 1.00 | |||
| glioblastoma cells | -3.78 | 2.02 | 1.50 |
Items per page:
1 – 3 of 3