rs1837366 chr2:111117052 C>T
- Sequence
agatgcctagcattggtccgccgt[C/T]tcactgtactgaatttcaagaatc
- ASB in cell types
- foreskin keratinocyte RH4 (alveolar rhabdomyosarcoma) GSC23 (Glioblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.85 | n/a | 2.67 | |||
| RH4 (alveolar rhabdomyosarcoma) | -0.46 | 1.64 | 2.00 | |||
| GSC23 (Glioblastoma) | 2.17 | n/a | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP b-cell chronic lymphocytic leukemia, diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), height, microalbuminuria, refractive error, rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Testis