rs1837372 chr2:111058057 T>G
- Sequence
acagctctgggggcagatttcatt[T/G]cagactgctttagaagacaggaca
- ASB in cell types
- germinal center B-cells
- ASB for transcription factors
- MEF2B_HUMAN CBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 3.62 | n/a | 2.00 | -4.48 | Concordant | |||
| CBP_HUMAN | 2.74 | -5.07 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP b-cell chronic lymphocytic leukemia, diastolic blood pressure (dbp), hdl cholesterol change with statins, infant head circumference, refractive error, triglycerides change with statins