rs1838766 chr2:119111799 C>T
- Sequence
gggtgagtagttcggcaggaaggg[C/T]ggttacagagcaggtgactcagga
- ASB in cell types
- ESO-26 (Gastroesophageal junction adenocarcinoma)
- ASB for transcription factors
- KLF5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KLF5_HUMAN | 2.38 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, birth weight, mitral annular calcium