rs183950 chr13:50511956 C>T
- Sequence
gaagagacaggggacaaatgatgt[C/T]ctggagtaggtgagtgcatttggg
- ASB for transcription factors
- ZN600_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN600_HUMAN | n/a | 2.16 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, bipolar disorder and major depressive disorder, body mass index (bmi), height, major depressive disorder, serum creatinine, triglycerides, waist hip ratio