rs183957 chr3:9862476 A>T
- Sequence
gggcgggtcactgagtcttggggg[A/T]cctgatgcctgtgcccttgatggt
- ASB in cell types
- transverse colon
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.78 | 0.44 | 1.06 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood