rs1840400 chr15:33021957 A>G
- Sequence
acacttaactagaataaaatttca[A/G]ctacaattgaaagtaaccaactcc
- ASB in cell types
- Kelly (neuroblastoma) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kelly (neuroblastoma) | 0.90 | 1.17 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.57 | 0.76 | 1.00 |
Items per page:
1 – 2 of 2