rs1840574 chr11:107043890 G>A
- Sequence
aacagttaccgagtctgagtcaac[G/A]gagtgtggtctgaggaagaatgtg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM23248
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | -2.52 | 2.84 | 1.00 | 5.07 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, rheumatoid arthritis, severe diabetic retinopathy, total cholesterol, years of education